

We will send you a primer mix for 100 PCR reactions for the fungal ITS1F and ITS4R primers. These primers can be used to amplify the Intergenic Spacer Region in Fungal DNA for use in identification. 50ul.
ITS1F
TCCGTAGGTGAACCTGCGG
ITS4R
TCCTCCGCTTATTGATATGC
More information can be found in White et al. 1990 Here
Haven't used the primers yet (can update soon), however Customer service is top notch